Isolation of Potentially Novel Brucella spp. from Frogs (2024)

Abstract

Bacterial isolates from frogs were phenotypically identified as Ochrobactrum anthropi, but 16S rRNA sequencing showed up to 100% identity with Brucella inopinata. Further analysis of recA, omp2a, omp2b, bcsp31, and IS711 and multilocus sequence analysis (MLSA) verified a close relationship with Brucella, suggesting the isolates may actually represent novel members of this growing genus of zoonotic pathogens.

TEXT

The classical Brucella species are B. abortus, B. melitensis, B. suis, B. ovis, B. neotomae, and B. canis. More recently, B. pinnipedialis and B. ceti were described (10, 15), followed by B. inopinata and B. microti (6, 12–14). To date, members of the genus Brucella have not been reported in amphibians as natural hosts.

We report the isolation and identification of unusual Gram-negative, non-spore-forming, motile Brucella-like coccoid bacteria isolated from wild-caught African bullfrogs (Pyxicephalus edulis) originating from Tanzania, which were found dead or moribund in a quarantine unit.

Tissue samples (liver, spleen, lung, heart, kidney, ovaries, gut, and skin) were cultured on Columbia sheep blood, Gassner's agar (Oxoid, Wesel, Germany), and brucella agar (Merck, Darmstadt, Germany) at 20°C and 37°C for up to 96 h in an aerobic and microaerophilic atmosphere (5% H₂, 10% CO₂, 85% N). From 18 isolates suspected of being Brucella, 13 were used for phenotypic analysis, and 8 of them were used for further molecular analysis. Field strains were tested with Gram's and Stamp's stain. Biochemical properties were assessed as described by Alton et al. (1). Growth was assessed on Brucella agar with and without crystal violet, agglutination with a complement fixation test (CFT) control serum (Institute Pourquier, Montpellier, France), and with mono-specific A, M, and R antisera (Anses, Maisons-Alfort, France) according to Alton et al. (1). Motility was additionally tested microscopically. For further biochemical characterizations, Vitek2 and API-20NE (bioMérieux, Nürtingen, Germany) were used according to the manufacturer′s instructions. Phage lysis testing was carried out as described elsewhere (1).

Following DNA purification, analysis was performed to determine the presence of the Brucella genus-specific bscp31 gene (3) and Brucella-specific insertion sequence 711 (IS711) (4), as well as by AMOS PCR (where “AMOS” represents the first letters of Brucella spp. abortus, melitensis, ovis, and suis, respectively) (5) and the Bruce-ladder multiplex PCR assay (9).

16S rRNA gene sequences were amplified (11), purified with the E.Z.N.A. MicroPlate Cycle Pure kit (Omega Biotek, Germany), sequenced by SEQLAB (Göttingen, Germany), and subjected to BLASTN analysis (2).

To establish relationships between Brucella and Ochrobactrum, eight-locus multilocus sequence analysis (MLSA) data (without int-hyp) (18) were compared against all 27 sequence types (STs) originally described and equivalent sequences of Ochrobactrum intermedium LMG3301^T and Ochrobactrum anthropi ATCC 49188^T. Sequences were concatenated, and phylogenetic analysis was performed using the MEGA4 package.

The entire coding regions of recA, omp2a, omp2b, bcsp31, and IS711 (orfA and orfB) from a single field strain (09RB8471) were extracted and subjected to BLASTN analysis for their relatedness to other sequences deposited in the database.

Isolates grew well without hemolysis on Columbia and Brucella agar with or without crystal violet at 20 and 37°C within 24 h, with better growth in an aerobic atmosphere, but not on Gassner's agar. Bacteria were Stamp-positive and Gram-negative small coccoid rods and showed positive reactions for catalase, cytochrome-oxidase, urease (within 20 to 30 min), and agglutination with a CFT control serum, but not with mono-specific A, M, and R antisera, according to Alton et al. (1). The colony morphology of the isolates stained with crystal violet was smooth since they did not take up dye. Oxidative and fermentative glucose metabolism, indole production, and H₂S production in all but two isolates gave negative results. The identification of all 13 strains by Vitek2 and API-20NE was Ochrobactrum anthropi, with a probability of 99.9%. All strains turned out to be motile. In electron microscopy, a single polar flagellum and pilus-like structures were visible (data not shown). Detailed data will be presented separately. The bacteria were not lysed by the phages Wb at the routine test dilution (RTD) and Tb at both the RTD and 10⁴ × RTD.

Strains were positive for IS711 and bcsp31, but AMOS PCR was negative. Five fragments each (152, 272, 450, 587, and 794 bp) were generated by the Bruce-ladder PCR (9).

The eight isolates subjected to molecular analysis comprised two distinct clusters based on the 16S rRNA gene sequence. BLASTN revealed the isolate Brucella inopinata BO1 (NCBI GenBank EU053207) (7) as the closest relative for one group (type A) with 100% sequence identity (1,212 bp). Type B isolates are most closely related with Ochrobactrum sp. strain ROi52 (NCBI GenBank EF219049) (15), and uncultured bacterium clone RO328 (NCBI GenBank EF219037) (15) with 98.6% identity (1,204 bp) due to an insertion of 44 nucleotides (nt) (CCTTTAAAATTCCAAGAAACATAAAATGCCTTGGCATTTTATGG) with highest similarity to Ochrobactrum. Two isolates were examined by MLSA and had novel alleles at all loci compared to all previously described strains and compared to each other. Phylogenetic reconstruction (Fig. 1) revealed that the two isolates cluster within the extended Brucella group that includes B. inopinata and other recently described Brucella isolates, such as isolate BO2 (16) and Australian rodent isolates (17), and are much more distantly related to Ochrobactrum species. Analysis of recA, bcsp31, and IS711 unequivocally demonstrated that the isolate examined is genetically most closely related to Brucella.

We isolated for the first time potentially novel Brucella spp. from a cold-blooded amphibian host. These findings significantly enhance the understanding of the ecological potential of the genus Brucella. Like B. inopinata and B. microti, the isolates of this study are fast-growing bacteria with a biochemical profile similar to that of Ochrobactrum (11). The presence of recA, bcsp31, and IS711 and MLSA analysis unequivocally demonstrated that the isolates are genetically most closely related to Brucella. The unusual agglutination properties may reflect an atypical lipopolysaccharide (LPS) gene cluster, as has been reported in strain BO2 (16), another atypical Brucella isolate. Additionally, motility is exceptional in Brucella, and these strains might represent the first motile Brucella species reported to date. All Brucella species are equipped with genes of the flagellar apparatus, and amotility is only based upon deletions and insertion within the flagellin operon. Under certain conditions, Brucella is indeed capable of formation of a sheathed flagellum (8). Therefore, investigations are under way to find the reason for this motility. Besides these taxonomical/phylogenetic aspects, the isolation of potential novel Brucella spp. from amphibians significantly extends the ecologic range of the genus and suggests that all vertebrate classes, including fish (7) and reptiles, may be able to serve as hosts for brucellae. Comparative whole-genome sequencing will provide further insight into the genetic relatedness of these atypical brucellae in comparison with the classical Brucella species.

ACKNOWLEDGMENTS

Footnotes

REFERENCES